Séquençage NGS haut-débit

Understand the genetic potential of your community samples Provides you with hypothesis-free taxonomic analysis Introduction Microbiome studies are often based on the sequencing of specific marker genes as for instance the prokaryotic 16S rRNA gene. Such amplicon-based approaches are well established and widely used. However, they have limitations such as the dependency on a single gene to analyze a whole community, the intro - duction of PCR bias and the restriction to describe only the taxonomic compo - sition and diversity. Shotgun metage - nomics is a cutting edge technique for microbiome analysis overcoming said limitations. Whole genomic DNA of a sample is isolated, fragmented and finally sequenced. This allows a detailed analysis of the taxonomic and functional composition of a microbial community. Metagenomics Analysis of Microbiota by Next Generation Shotgun Sequencing Microsynth Competences and Services Microsynth offers a full shotgun metagenomics service for taxonomic and functional profiling of clinical, envi - ronmental or engineered microbiomes. The service covers the entire process from experimental design, DNA isola - tion, tailored sequencing to detailed and customized bioinformatics analy - sis. A major advantage of Microsynth’s shotgun metagenomics service is the project specific consulting and support by our experienced NGS specialists. Experimental Design: Microbiome profiling by shotgun metagenomics often means sequencing of numerous samples generating millions or even billions of reads. To gain reliable and high-quality data, a well-planned experi - mental design including replicates and a clear scientific hypothesis is essential [1]. Our NGS specialists will assist you from the beginning. DNA Isolation: Total DNA is either iso - lated by the customer or this critical step is outsourced. Microsynth has over 15 years of experience in nucleic acid iso - lation from various demanding matrices such as food, stool, eukaryotic tissues (plants, animals, human), water or soil. Tailored NGS Sequencing: Microsynth will tailor the whole sequencing process to your project requirements, thus pro - viding you with just the right amount of data to answer your questions. Bioinformatics: Taxonomic and func - tional analysis of metagenomic data - sets is challenging. Alignment, binning and annotation of the large amounts of sequencing reads require expertise and sufficient computational power. Microsynth offers cutting edge bio - informatics analysis for your shotgun sequencing data using published and well-established methods. Our analysis pipeline will be adjusted to your specific requirements to guarantee scientifically reliable results for your project. After quality processing the reads are aligned against a protein reference database (e.g. NCBI nr). Taxonomic and functional binning and annotation are performed. The analysis is not restricted to prokar - yotes but also includes eukaryotes and viruses. The output comprises all reads, alignments as well as the taxonomic and functional annotation. Together with the raw and processed data, an HTML report is sent, which facilitates the examination, filtering and sorting of the data. Shotgun Metagenomics AnalysisProject Output: Soil Samples DNA Isolation Illumina DNA Library Preparation Illumina 2 x 150 bp Sequencing Option I: Samples Option II: Isolated DNA Project Input: Report Generation Option III: Bioinformatics only Experimental Design Option I: Library Prep only Option II: Raw Data only Option III: Full Report Microsynth AG, SwitzerlandSch?tzenstrasse 15 ? P.O. Box ? CH - 9436 Balgach ? Phone + 41fi71fi722fi83 33 ? Fax + 41fi71fi722fi87 58 ? info @microsynth.ch ? www.microsynth.com THE SWISS DNA COMPANY Application Note ? Next Generation Sequencing Microbiome Data Analysis Examples Microsynth’s analysis pipeline provides you with full flexibility regarding data inspection and analysis. It allows you to analyze and visualize the taxonomic and functional composition of your micro - biome dataset in a single user friendly interface. A major advantage is the pos - sibility to import metadata such as envi - ronmental para-meters or experimental conditions for further statistical analysis. On all levels, data can easily be exported in prevalent formats, giving you the pos - sibility to specifically extract the relevant information from your dataset and use the data for downstream analysis and figure generation. Taxonomic content can be explored on all ranks from domain level down to the species level covering the whole NCBI taxonomy (see Figure 1 ). Functional annotation is based on differ - ent functional classification systems such as InterPro, KEGG, eggNOG or SEED. All systems contain a functional hierarchy ranging from general classifications such as metabolism or cellular functions (see Figure 2 ) down to single enzymes and subunits. Beside the analysis of single samples, multiple sample comparisons are possible (see Figure 3 ). Samples can be grouped and metadata information can be included in the analysis. Various beta diversity measures can be chosen for sample comparison. Further Reading 1. Knight et al. (2012) Unlocking the potential of metagenomics through replicated experimental design, Nat Biotechnol, 30, 513-520. Figure 1. Word cloud representing the bacterial composition on the phylum level in a sample. The size of the words is proportional to the number of assigned reads. Figure 2. Radial tree chart representing the KEGG functions carbohydrate metabolism and energy metabolism and the related subgroups. The size of the sections in each hierarchy is proportional to the number of assigned reads. Figure 3. PCoA for multi-sample comparison based on Bray-Curtis dissimilarities for the InterPro functional annotation. Related Topics • 16S Metagenomics Sequencing • Amplicon Deep Sequencing • Bioinformatics Services • DNA/RNA Isolation Microsynth AG, SwitzerlandSch?tzenstrasse 15 ? P.O. Box ? CH - 9436 Balgach ? Phone + 41fi71fi722fi83 33 ? Fax + 41fi71fi722fi87 58 ? info @microsynth.ch ? www.microsynth.com THE SWISS DNA COMPANY Application Note ? Next Generation Sequencing

Determine the sequence type of microbial isolates Screen for resistance, virulence, and mycotoxin genes Identify genetic variations that lead to pathogenicity Introduction Genomic epidemiology studies are useful to support public health, combat infectious diseases, maintain food safety, or establish sustainable produc - tion lines. To support our customers in these diverse applications, Microsynth has developed a genomic epidemiology pipeline that allows addressing numer - ous scientific topics concerning your epidemiology project: • Resolve the taxonomy of individual species or sequence type (ST ) • Identify resistance, virulence and myco - toxin genes • Detect multidrug resistant bacterial pathogens (MDR) • Detect acquired mutations and assess their potential functional effects • Establish a population-level profiling and comparison of antimicrobial resis - tance Our genomic epidemiology analysis pipeline is based on next generation whole genome sequencing. The gener - ated data and knowledge will support production lines, can be used to track transmission, or used in pathogen out - break surveillance, to just name a few examples. At Microsynth we will guide you through the whole analysis to assure you will achieve your goals. Genomic Epidemiology Analysis Microsynth’s Competences and Services With more than 10 years of experience in the field of next generation sequencing, one of Microsynth’s core competences is to provide high quality one-stop ser - vices from experimental design to bio - informatics analysis. You may either out - source the entire analysis or only single steps to us as illustrated in Figure 1 . Experimental Design Microsynth’s NGS specialists will help you define suitable experimental setups for your genomic epidemiology analysis projects and discuss possible strategies to address your research questions. DNA Isolation You may either perform the DNA extrac - tion yourself or outsource this critical step to Microsynth. We have long-stand - ing experience in processing various sample matrices and DNA/RNA sources. Figure 1. Microsynth’s workflow for genomic epidemiology analysis projects. The workflow can be entered and exited at various steps depending on the requirements of the customer. Genomic Epidemiology AnalysisProject Output: Staphylococcus aureus DNA Isolation Illumina TruSeq Library Preparation Illumina NextSeq (2x150bp) Sequencing Option I: Samples Option II: Isolated DNA Project Input: Report Generation Option III: Bioinformatics only Experimental Design Option I: Library Prep only Option II: Raw Data only Option III: Full Report Microsynth AG, SwitzerlandSch?tzenstrasse 15 ? P.O. Box ? CH - 9436 Balgach ? Phone + 41fi71fi722fi83 33 ? Fax + 41fi71fi722fi87 58 ? info @microsynth.ch ? www.microsynth.com THE SWISS DNA COMPANY Application Note ? Next Generation Sequencing Example Results Bioinformatics Analysis Thanks to the use of modern methods and algorithms, hundreds of samples can be analyzed in detail for any genomic epidemiology project. Depending on the focus of the project, many different approaches to bioinformatic analysis are possible, but two example scenarios are described in the next section. In the first example scenario, the genomes contained in the samples come from well-studied model organisms. However, since the composition of the samples is unknown, a shotgun meta - genome analysis is performed first to determine whether the samples contain pure strains or whether meta-communi - ties exist, and in both cases the taxonomy is determined (see Table 1 ). Assuming that the samples contain pure strains of a well-studied micro-organism, one of the established Multi Locus Sequence Typing (MLST ) schemes can be used to determine its sequence type, which goes beyond the determination of the species alone (see Table 2 ). Next, in order to reconstruct the strains contained in the samples, the filtered sequencing reads are de novo assem - bled into contigs on which genes are predicted and annotated. The predicted genes are then screened for homologous sequences among the known resistance, virulence, and mycotoxin genes. Single nucleotide variations (SNVs) and small insertions and deletions (InDels) are determined in comparison to the public reference sequences (see Table 3 ). In the second scenario, the microor - ganisms to be analyzed are neither well studied nor publicly documented. In this case, determining the similarity of the unknown genomes to any of the genomes stored in the RefSeq [1] data - base first and second annotate pre - dicted genes with homologues found for instance in the Pfam [2] database (see Table 4 ) are sensible first steps. If no exact phylogenetic relationship is known for the hundreds of samples involved in a genomic epidemiology project, clus - tering can be used to establish groups of samples that may then be further ana - lyzed on their own [3] (see Figure 2 ). Table 1. This cutout of a result of a shotgun metagenomics taxonomy assignment, shows the composition of the bacterial community found in the analyzed sample. In this case, the sample contains 96 % of the Staphylococcus genus (Tax Level: G) and 92% are identified as Staphylococcus aureus species (Tax Level: S). Table 2. The result of an MLST showing the sequence type of the species found in the sample. In this case, the scheme used for typing included seven genes (arcC, aroE, glpF, gmk, pta, tpi and yqiL) to identify the respective ST and Clonal Complex (CC). The numbers in the gene columns represent different variants of these genes found in the PubMLST database [4]. Table 3. Summary table of the number of observed SNVs and small InDels in the analyzed sample including the type of mutation (silent and non-silent). Percent Tax Level Tax ID Tax Name 100.00 D 2 Bacteria 100.00 P 1239 Firmicutes 100.00 C 91061 Bacilli 96.00 O 1385 Bacillales 96.00 F 90964 Staphylococcaceae 96.00 G 1279 Staphylococcus 92.00 S 1280 Staphylococcus aureus Sample arcC aroE glpF gmk pta tpi yqiL ST Clonal Complex sample1 1 4 1 8 4 4 3 72 CC8 Sample SNV InDels Silent Non-silent sample1 236 12 171 53 Library Preparation and Sequencing Following a quality check of your samples, Microsynth will build Illumina libraries including specific adaptors with barcodes. Depending on the experimen - tal design, the libraries are pooled and sequenced either on the Illumina MiSeq or NextSeq 500/550. These flexible plat - forms allow for optimal sequencing depending on the number of samples and on the required read length. Microsynth AG, SwitzerlandSch?tzenstrasse 15 ? P.O. Box ? CH - 9436 Balgach ? Phone + 41fi71fi722fi83 33 ? Fax + 41fi71fi722fi87 58 ? info @microsynth.ch ? www.microsynth.com THE SWISS DNA COMPANY Application Note ? Next Generation Sequencing Related Services Microsynth also provides microbial resequencing services that focus on the detection of genetic variations in relation to a refer - ence sequence. References [1] O’Leary NA, Wright MW, Brister JR, Ciufo S, Haddad D, McVeigh R, Rajput B, Robbertse B, Smith-White B, Ako-Adjei D, Astashyn A, Badretdin A, Bao Y, Blinkova O, Brover V, Chetvernin V, Choi J, Cox E, Ermolaeva O, Farrell CM, Goldfarb T, Gupta T, Haft D, Hatcher E, Hlavina W, Joardar VS, Kodali VK, Li W, Maglott D, Masterson P, McGarvey KM, Murphy MR, O’Neill K, Pujar S, Rangwala SH, Rausch D, Riddick LD, Schoch C, Shkeda A, Storz SS, Sun H, Thibaud-Nissen F, Tolstoy I, Tully RE, Vatsan AR, Wallin C, Webb D, Wu W, Landrum MJ, Kimchi A, Tatusova T, DiCuccio M, Kitts P, Murphy TD, Pruitt KD. Reference sequence (RefSeq) database at NCBI: current status, taxonomic expansion, and functional annotation. Nucleic Acids Res . 2016 Jan 4;44(D1):D733-45 PubMed [2] S. El-Gebali, J. Mistry, A. Bateman, S.R. Eddy, A. Luciani, S.C. Potter, M. Qureshi, L.J. Richardson, G.A. Salazar, A. Smart, E.L.L. Sonnhammer, L. Hirsh, L. Paladin, D. Piovesan, S.C.E. Tosatto, R.D. Finn. The Pfam protein families database in 2019. Nucleic Acids Research (2019) doi: 10.1093/nar/gky995 [3] Lees JA, Harris SR, Tonkin-Hill G, Gladstone RA, Lo SW, Weiser JN, Corander J, Bentley SD, Croucher NJ. Fast and flexible bacterial genomic epidemiology with PopPUNK. Genome Research 29:1-13 (2019). doi: 10.1101/gr.241455.118 [4] Website ( https://pubmlst.org/mlst/ ) sited at the University of Oxford (Jolley et al. Wellcome Open Res 2018, 3:124 [version 1; ref - erees: 2 approved]). The development of this site has been funded by the Wellcome Trust. Figure 2. Clustering of a large numbers of samples with unknown phylogenetic relationship resulting in four distinct groups. Table 4. Detail of a table showing the homologous protein domains and their significance found for the predicted genes of the analyzed sample. Target Name Accession Query Name E-value Score Description of Target TPK_catalytic PF04263.16 gene_8|401_aa|-|7047|8252 0.00038 20.5 Thiamin pyrophosphokinase, catalytic domain CRISPR_Cas9_WED PF18061.1 gene_40|840_aa|-|40414|42936 0.12 12.4 CRISPR-Cas9 WED domain Microsynth AG, SwitzerlandSch?tzenstrasse 15 ? P.O. Box ? CH - 9436 Balgach ? Phone + 41fi71fi722fi83 33 ? Fax + 41fi71fi722fi87 58 ? info @microsynth.ch ? www.microsynth.com THE SWISS DNA COMPANY Application Note ? Next Generation Sequencing

Explore the microbial community composition of your samples Compare taxonomic shifts within a given experimental setup Introduction Microbial communities are present in almost every environment. They are important drivers of biogeochemical processes, have a large influence on human health and harbor enormous potential for biotechnological applica - tions. A major goal in the analysis of a microbial community is to identify its taxonomic composition and diversity. Sequencing of the ribosomal RNA (rRNA) gene and its internal spacer regions has become the gold standard for the identi - fication of microorganisms such as bac - teria, archaea and fungi. Its presence in all living organism, the combination of conserved and hypervariable genetic regions and the availability of curated reference databases make the rRNA gene an ideal phylogenetic marker. The com - bination of next generation sequencing (NGS) of partial regions of the rRNA gene combined with adequate bioinformatics analysis is a powerful tool to explore the composition of microbial communities. Amplicon Metagenomics – 16S/ITS Choice of the Primer System Amplicon metagenomics is based on NGS sequencing of the microbial rRNA gene. Since NGS read lengths are limited, only parts of the rRNA gene can be amplified and sequenced. For prokaryotes, the analysis targets hyper - variable regions (V1-9) on the 16S rRNA gene, while for fungi the internal tran - scribed spacer regions (ITS) are used for taxonomic profiling (see Figure 1 ). An ideal primer system should be uni - versal enough to cover a broad range of taxonomic groups, while the result - ing amplicon must provide enough tax - onomic information for a reliable tax - onomic classification. Based on our experience and the validation of our 16S/ITS analysis pipeline, we recom - mend the primer systems displayed in Table 1 . Our service is not restricted to the displayed marker genes and primer systems, also other phyloge - netic marker genes (e.g. cytochrome c oxidase I) and primer systems can be used. A pilot study can be very helpful to find the best primer system for your specific research question. Figure 1. Overview of loci of ribosomal gene loci commonly used for the taxonomic analysis of microbial communities. Hypervariable regions are marked in green while conserved regions are marked in grey. A. Structure of the prokaryotic 16S rRNA gene showing the nine hypervariable regions (V1-V9) and the regions targeted by the commonly used primer systems. B. Organization of the fungal rRNA gene operon showing two internal transcribed spacer regions (ITS). ITS2 is most often used for profiling fungal communities. Primer Name Sequence (5’-3’) Region Size (bp) Source 515F (Parada) 806R (Apprill) GTGYCAGCMGCCGCGGTAA GGACTACNVGGGTWTCTAAT V4 ~300 [1] 341F 805R CCTACGGGNGGCWGCAG GACTACHVGGGTATCTAATCC V34 ~460 [2] ITS3 ITS4 GCATCGATGAAGAACGCAGC TCC TCCGC T TAT TGATATGC ITS2 300-400 [3] Table 1. Recommended and commonly used universal primer systems for prokaryotic (515F/806R, 341Fl/805R) and fungal (ITS3/ITS4) microbiome profiling. Only template specific sequences are shown. For Illumina-Sequencing the primer sequences must be combined with Illumina adaptor sequences in a two-step PCR approach. For further information consult our application note for Amplicon Deep Sequencing (https:// www.microsynth.ch/amplicon-deep-sequencing.html). Microsynth AG, SwitzerlandSch?tzenstrasse 15 ? P.O. Box ? CH - 9436 Balgach ? Phone + 41fl71fl722fl83 33 ? Fax + 41fl71fl722fl87 58 ? info @microsynth.ch ? www.microsynth.com THE SWISS DNA COMPANY Application Note ? Next Generation Sequencing Microsynth Competences and Services Microbial community profiling is one of Microsynth’s core competences. Based on our extensive experience, we provide a one-stop service from experimental design to bioinformatics analysis (see Figure 2 ). You can either outsource the whole process or only single steps to us. We validated our whole amplicon metagenomics pipeline and the includ - ing methods by sequencing and analysis of two well characterized mock commu - nities. For further information on our val - idation process and possibilities to vali - date your own study, please contact us. Experimental Design The gain and impact of a study is highly dependent on its experimental design. The use of replicates, controls and appro - priate sampling methods are only a few examples of important points to con - sider. Make use of our experience; our NGS specialists will assist you from the start. DNA Isolation Microorganisms are highly diverse regarding their physiology and are often associated with surfaces like soil particles or are organized in stable agglomera - tions such as biofilms. DNA extraction of complex matrices is challenging. You can either perform the extraction yourself or outsource this critical step. Microsynth has extensive experience in DNA and RNA isolation from various matrices (e.g. soil or feces). PCR Amplification PCR amplification follows a two-step protocol. In a first step the locus-specific sequence is amplified, while in a second step the Illumina sequencing adaptors and indices are added. For projects with very low amounts of starting material we recommend our three-step PCR protocol including two subsequent locus-specific PCRs to increase the yield of sequence- able amplicons. NGS Sequencing Sequencing is performed on the Illumina MiSeq system. The MiSeq allows high throughput profiling at low cost, sup - porting read lengths up to 2x300 bp. Bioinformatics Analysis Microsynth’s amplicon metagenomics analysis is based on up-to-date and pub - lished bioinformatics software such as USEARCH [4] to get meaningful and relia - ble results for your sequencing data. 16S/ ITS analysis includes extensive quality fil - tering, denoising of operational taxo - nomic units (OTU), taxonomic classifi - cation based on various databases and alpha diversity analysis (i.e. OTU diver - sity within a given sample). Depending on the aim of the study and the exper - imental design (conditions, replicates), Microsynth also offers a complementary module for comparative statistics. This module includes beta diversity analysis (i.e. OTU diversity across samples) and determination of differentially abun - dant OTUs including appropriate statis - tical measures. The results are presented in an interactive and understandable format, including guidance through the results by our bioinformatics experts. Figure 2. Microsynths workflow for amplicon metagenomics projects. The workflow can be entered and exited at various steps dependent on the customers' requirements. Example Results of the 16S/ITS Analysis Microsynth’s analysis pipeline provides you with a full characterization of the microbial communities in your samples. Alpha diversity measures provide an overview on OTU richness and diversity within the samples (see Figure 3 ). Microsynth AG, SwitzerlandSch?tzenstrasse 15 ? P.O. Box ? CH - 9436 Balgach ? Phone + 41fl71fl722fl83 33 ? Fax + 41fl71fl722fl87 58 ? info @microsynth.ch ? www.microsynth.com THE SWISS DNA COMPANY Application Note ? Next Generation Sequencing Figure 3 . Examples for alpha diversity results. 3A. Rarefaction curves indicating whether sampling and sequencing covered the sample richness. 3B. Alpha diversity measures for the analyzed community including observed richness, Chao 1 indices representing the estimated richness and the Shannon diversity indices.
               
     

 
        !   " " " " " " " "  !#$%  #
 #&  #'  #(  #)  #* %  + ,   " +-   !#  !#.  !

*/&
*/)
*/(
0/) &/'
/1 2  "   23    3    3 ' *
1/0  !
0& / &/&
0/1
'/

/'
&/*2 "  2  2 2   #
2  ' &)
*/&  !&
)/1
)/)
)/1
)/
(/

)/' 2  "   22    +    +  ' )
)/&  !'
&/)
&/(
&/

(/)
)/
(/ 2     -      4    4       & 1&
' /*  !(
'/1
'/*
'/'
&/
&/(

/) 2  "   2 2  3    3  &)* 
&/  !) 0/
& 0/(
0/**

/)
&/

/)2   -   4    4     4     &

 
/)  !* */1 */
0 */((/*)0/&(0/'12     -             
)' 1 /*(  !1 */* */&0 */))/0
)/11*/&)2  "   23    4     4   
&) */&( Table 2. This detail of a sortable results table lists relative abundances and taxonomic identification of observed OTUs in the different samples. For taxonomic classi - fication confidence values are calculated and OTUs are only classified up to a specific rank if its confidence value is above a preset threshold to avoid dubious classifi - cations and false-positive results.
























          


















   


















            
    ! " 

  # Various reference databases are avail - able for the taxonomic classification of OTUs. Classifications are only shown to the taxonomic level, where the classi - fication fulfills certain confidence cri - teria in order to prevent false positive results. All observed OTUs are displayed together with their taxonomy and the relative abundance within the samples (see Table 2 ). Microsynth AG, SwitzerlandSch?tzenstrasse 15 ? P.O. Box ? CH - 9436 Balgach ? Phone + 41fi71fi722fi83 33 ? Fax + 41fi71fi722fi87 58 ? info @microsynth.ch ? www.microsynth.com THE SWISS DNA COMPANY Application Note ? Next Generation Sequencing References [1] https://earthmicrobiome.org/protocols-and-standards/16s/, accessed June 2021 [2] Klindworth et al. (2013) Evaluation of general 16S ribosomal RNA gene PCR primers for classical and next-generation sequencing-based diversity studies, Nucleic Acid Res, 41, e1. [3] White et al. (1990) Amplification and sequencing of fungal ribosomal RNA genes for phylogenetics, in PCR protocols. A guide to methods and applications, San Diego, Academic Press Inc., 315–322. [4] Edgar (2016) UNOISE2: Improved error-correction for Illumina 16S and ITS amplicon reads. bioRxiv, 081257, doi: https://doi.org/10.1101/081257. Comparative Statistics Microsynth’s comparative statistical module requires an adequate experi - mental design including sample repli - cates and at least two conditions that can be compared (e.g. treatment versus control). To obtain statistically valid results, we recommend using at least three biological replicates per condi - tion. The analysis includes beta diver - sity calculations which are presented in various graphs including principal com - ponent analysis plots (see Figure 4A ) and network or tree graphs display - ing similarities and differences between the samples. The major outcome of this module is the identification of OTUs that are differentially abundant between the chosen conditions together with appro - priate statistical measures. The differen - tially abundant OTUs are summarized in an interactive table, allowing an easy identification of significant changes in an OTUs abundance (see Figure 4B ). Figure 4. Examples for beta diversity results. 4A. Principal component analysis plot to visualize sample clustering. 4B. This detail of a results table shows differential abundance of OTUs between two conditions, including statistical measures for differential abundance (log fold change) and significance (adjusted p-value). base - Mean: mean OTU size; lfcSE: standard error; stat: Wald statistic; p-value: Wald test p-value; padj: p-value adjusted for multiple testing. Other Analysis Possibilities for Microbial Communities For the analysis of the functional poten - tial of a microbial community, shotgun metagenomics is the method of choice. We offer a full shotgun metagenomics service providing you with full flexibil - ity regarding the analysis of your results. For further information see our shotgun metagenomics application note. In case you are interested in the actively expressed genes of a microbial commu - nity our shotgun metatranscriptomics service offers an appropriate solution.
         
        
                     !" #       $  % &  
'() *
+ *,  '*'-, *( - *

   
(' -
 *+)' *) )

*- *-' ,
*() (   ' *
)' *-,*'
*
( -
*
( -  , -'
 *
+) * ' )*
*) 


*)( 

 - -) *), *)((*+(
* , *-
   ' ,' * * 
*

' *' 
)
*' 
'  ) '- *-'+ *- ,' 
*' (*+ ) ,*+
'  + ( *- *-,-*+ *,- ) *)+ )
                   


       Microsynth AG, SwitzerlandSch?tzenstrasse 15 ? P.O. Box ? CH - 9436 Balgach ? Phone + 41fi71fi722fi83 33 ? Fax + 41fi71fi722fi87 58 ? info @microsynth.ch ? www.microsynth.com THE SWISS DNA COMPANY Application Note ? Next Generation Sequencing